View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14715_high_14 (Length: 253)
Name: NF14715_high_14
Description: NF14715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14715_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 17 - 108
Target Start/End: Original strand, 2550600 - 2550691
Alignment:
| Q |
17 |
tttttcacgtctacttcttttcataaacattgatttattataaatttcacatctactattataactttgtatcttttacgacttgtcagttc |
108 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2550600 |
tttttcacgtttacttcttttcataaacattgatttattataaatttcaaatctactattataactttgtatcttttacgacttgtcagttc |
2550691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 241
Target Start/End: Original strand, 2550767 - 2550825
Alignment:
| Q |
184 |
aaaattgtcaattgcatattgcaaaa-aatagcgttatatttaaattttgctattctct |
241 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
2550767 |
aaaattgtcaattgcatattgcaaaaaaatagcgttttatttaaattttgctattctct |
2550825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University