View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14715_low_19 (Length: 238)
Name: NF14715_low_19
Description: NF14715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14715_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 3302994 - 3303199
Alignment:
| Q |
16 |
tcacagaaggccaaaaattacatacttgcacatttacgagtgcgagaaattctcagtaaggaactaagccagtctaaattgtttatatgatgtttagtaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3302994 |
tcacagaaggccaaaaattacatacttgcacatttacgagtgcgagaaattctcagtaagtaactaagccagtctaaattgtttatatgatgtttagtaa |
3303093 |
T |
|
| Q |
116 |
gaaaatggacccccttcactcgggatatctctacattcacacagtcaatgcattggtgaccgttggtttcagatcgaactcttcacaaaatatgtacatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3303094 |
gaaaatggacccccttcactcgggatatctctacattcacacagtcaatgcattggtgaccgttggtttcagatcgaactcttcacaaaatatgtacatt |
3303193 |
T |
|
| Q |
216 |
ttgatt |
221 |
Q |
| |
|
|||||| |
|
|
| T |
3303194 |
ttgatt |
3303199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 222
Target Start/End: Original strand, 25483033 - 25483106
Alignment:
| Q |
149 |
cattcacacagtcaatgcattggtgaccgttggtttcagatcgaactcttcacaaaatatgtacattttgattt |
222 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| ||||||| | || ||||||||| ||| | |||||||||| |
|
|
| T |
25483033 |
cattcacacagtcagtgcattggtgactgttggattcagattggacaattcacaaaaaatgcagattttgattt |
25483106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University