View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14715_low_22 (Length: 231)
Name: NF14715_low_22
Description: NF14715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14715_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 47501198 - 47501392
Alignment:
| Q |
18 |
caaaggggacaacgcatggcagttaacagcagcaacaatggttgggcttcaaagcattcccgggcttgtcatactttacggaagcctagtgaagaaaaca |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47501198 |
caaaggggacaacgcatggcaattaacagcagcaacaatggttgggcttcaaagcattcccgggcttgtcatactttacggaagcctagtgaagaaaaca |
47501297 |
T |
 |
| Q |
118 |
tgggctataaactcagctttcatggccttctatgcatttgcatccgttctcctttgttgggtttcatgggcataccaaatgtcatttggggagaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47501298 |
tgggctataaactcagctttcatggccttctatgcatttgcatccgttctcctttgttgggtttcatgggcataccaaatgtcatttggggagaa |
47501392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 188
Target Start/End: Original strand, 31605709 - 31605872
Alignment:
| Q |
25 |
gacaacgcatggcagttaacagcagcaacaatggttgggcttcaaagcattcccgggcttgtcatactttacggaagcctagtgaagaaaacatgggcta |
124 |
Q |
| |
|
||||| |||||||| |||||||||||||| | || || ||||||| |||| |||||||| ||||| || || ||| | || ||||||| |||||| |
|
|
| T |
31605709 |
gacaatgcatggcaactaacagcagcaacattagtaggccttcaaactgttcctgggcttgtaatactctatggcagcatggttaagaaaaaatgggccg |
31605808 |
T |
 |
| Q |
125 |
taaactcagctttcatggccttctatgcatttgcatccgttctcctttgttgggtttcatgggc |
188 |
Q |
| |
|
|||| || |||||||||||| | ||||||||||| | || || |||||||||||| |||||| |
|
|
| T |
31605809 |
taaattcggctttcatggccctatatgcatttgctgctgtactagtttgttgggttttatgggc |
31605872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University