View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14715_low_25 (Length: 215)
Name: NF14715_low_25
Description: NF14715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14715_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 14 - 158
Target Start/End: Complemental strand, 26880691 - 26880547
Alignment:
| Q |
14 |
gcataggtatgttcatttccataaactcttaccatcttaatttttatgtcttgttgcttgcggtgttgtgtttttagggcaagttttttccgaagcattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26880691 |
gcataggtatgttcatttccataaactcttaccatcttaattttcatgtcttgttgcttgcggtgttgtgtttttagggcaagttttttccgaagcattt |
26880592 |
T |
|
| Q |
114 |
aattttcactgatgaaagttttgtattttgatgataccagtaatg |
158 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
26880591 |
aattttcactgataaaagttttgtattttgatgataacagtaatg |
26880547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University