View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14715_low_8 (Length: 404)
Name: NF14715_low_8
Description: NF14715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14715_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 47 - 393
Target Start/End: Complemental strand, 35161524 - 35161179
Alignment:
| Q |
47 |
agtgaagtgcaaaagttaggaaggaggatgacttcaaactgtatatatggatgatatgattaaattctagaatccaaacacaaaaaacatgtctcaaatc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35161524 |
agtgaagtgcaaaagttaggaaggaggatgacttcaaactctatatatgtatgatatgattaaattctagaatccaaacacaaaaaacatgtctcaaatc |
35161425 |
T |
|
| Q |
147 |
taaaatctggacaaggtcgtttttggaaatttaaggggcgtgagcgtgagagatgtgggggtgggnnnnnnntttcacgaattataattccaagcccagt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
35161424 |
taaaatctggacaaggtcgtttttggaaatttaaggggcgtgagcgtg-gagatgtgggggtggtaaaagaatttcacgaattataattcgaagcccagt |
35161326 |
T |
|
| Q |
247 |
ccacaaaaactgcaaccctaaaacaacaaaacagccgttcacgtaaacccttcccctcttcaagactcacctcgcttatcgaactccctgcctccggcgc |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35161325 |
ccacaaaaactgcaaccctaaaacaacaaaacagccgttcacgtaaacccttcccctcttcaagactcacctcgcttatcgaactccctgcctccggcgc |
35161226 |
T |
|
| Q |
347 |
tgcattccgccgccgataccagtctccggccacctctcctttgcttc |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35161225 |
tgcattccgccgccgataccagtctccggccacctctcctttgcttc |
35161179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University