View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14716_high_15 (Length: 238)
Name: NF14716_high_15
Description: NF14716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14716_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 172
Target Start/End: Complemental strand, 51062186 - 51062031
Alignment:
| Q |
17 |
actattgatcctgatcgatgaatcattagataaagatatgaagcacttctcaccttggtaattcattttgtggtacaccatttgaaaactagttctctta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51062186 |
actattgatcctgatcgatgaatcattagataaagatatgaagcacttctcaccttggtaattcattttgtggtacaccaattgaaaactagttctctta |
51062087 |
T |
|
| Q |
117 |
cccagatccaactttataactattatttcatttctaaagtgtcaatggaaaactct |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51062086 |
cccagatccaactttataactattatttcatttctaaagtgtcaatggaaaactct |
51062031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 220
Target Start/End: Complemental strand, 51062031 - 51062000
Alignment:
| Q |
189 |
ttggatactacaggttctaaacccacaccacc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51062031 |
ttggatactacaggttctaaacccacaccacc |
51062000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University