View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14716_high_17 (Length: 224)

Name: NF14716_high_17
Description: NF14716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14716_high_17
NF14716_high_17
[»] chr7 (1 HSPs)
chr7 (52-207)||(45143402-45143556)


Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 52 - 207
Target Start/End: Complemental strand, 45143556 - 45143402
Alignment:
52 acattaatttggtggatgtattgtttgtttgggtctctccttcttaatttgattcagaattagtatcctatctccatcatatgatatgatgactattaga 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45143556 acattaatttggtggatgtattgtttgtttgggtctctccttcttaatttgattcagaattagtatcctatctccatcatatgatatgatgactattaga 45143457  T
152 nnnnnnnnctctcctgtacacactaggctgttcttgtggaactaggcctttgaatg 207  Q
            |||||||||||||||||||||||||||||||||||| |||||||||||    
45143456 ttttttttctctcctgtacacactaggctgttcttgtggaacta-gcctttgaatg 45143402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University