View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14716_low_17 (Length: 233)
Name: NF14716_low_17
Description: NF14716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14716_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 9503178 - 9503388
Alignment:
| Q |
11 |
caaaaacatcaccacatgatagccaacattgtaggatcatattgcatagattcattgttggacactacataaacagatgttcaacacttccattttggta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9503178 |
caaaaacatcaccacatgatagccaacattgtaggatcatattgcatagattcattgttggacactacataaacagatgttcaacacttccattttggta |
9503277 |
T |
 |
| Q |
111 |
gttatttctagtttagaaataatcttcccatgtctgcaacacacccagcctgattctaaaaatctaatttctttgatcactttatttttcctacagaatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9503278 |
gttatttctagtttagaaataatcttcccatgtctgcaacacacccagcctgattctaaaaatctaatttctttgatcactttatttttcctacagaatg |
9503377 |
T |
 |
| Q |
211 |
ttacgtctgat |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
9503378 |
ttacgtctgat |
9503388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 153 - 213
Target Start/End: Original strand, 770620 - 770679
Alignment:
| Q |
153 |
acccagcctgattctaaaaatctaatttctttgatcactttatttttcctacagaatgtta |
213 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
770620 |
acccagcctgattctaaaaatgtaattt-tttgatcactttatttttcctacagaatgtta |
770679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 105 - 149
Target Start/End: Original strand, 770545 - 770589
Alignment:
| Q |
105 |
ttggtagttatttctagtttagaaataatcttcccatgtctgcaa |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
770545 |
ttggtagttatttctagtttagaaataatcttcccatgtctgcaa |
770589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 72
Target Start/End: Original strand, 770265 - 770323
Alignment:
| Q |
11 |
caaaaacatcaccacatgatagccaacattgtaggatcatattgcatagattcattgttgga |
72 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
770265 |
caaaaaaatcaccacatgatagccaag---gtaggatcctattgcatatattcattgttgga |
770323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University