View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14716_low_19 (Length: 224)
Name: NF14716_low_19
Description: NF14716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14716_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 52 - 207
Target Start/End: Complemental strand, 45143556 - 45143402
Alignment:
| Q |
52 |
acattaatttggtggatgtattgtttgtttgggtctctccttcttaatttgattcagaattagtatcctatctccatcatatgatatgatgactattaga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45143556 |
acattaatttggtggatgtattgtttgtttgggtctctccttcttaatttgattcagaattagtatcctatctccatcatatgatatgatgactattaga |
45143457 |
T |
 |
| Q |
152 |
nnnnnnnnctctcctgtacacactaggctgttcttgtggaactaggcctttgaatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45143456 |
ttttttttctctcctgtacacactaggctgttcttgtggaacta-gcctttgaatg |
45143402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University