View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14717_low_8 (Length: 246)
Name: NF14717_low_8
Description: NF14717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14717_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 241
Target Start/End: Original strand, 47421994 - 47422219
Alignment:
| Q |
16 |
gatatttggttaattatgtcaatcgttgtgtgcagtaagctagctgagcttgggatcaagaagagtgctcaaaattgtaaggagaagtttgaacatgaga |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47421994 |
gatatttggttaattatgtcaattgttgtgtgcagtaagctagctgagcttgggatcaagaagagtgctcaaaattgtaaggagaagtttgaacatgaga |
47422093 |
T |
|
| Q |
116 |
atgcatcattttccccccggttcgttagcgagcttcaagatctttatcaaggtggtggtgttagtgttgacgaaaacacccaacacgaagaagatgatag |
215 |
Q |
| |
|
| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47422094 |
acgcatcatttttcccccggttcgttagcgagcttcaagatctttatcaaggtggtggttttagtgttgacgaaaacacccaactcgaagaagatgatag |
47422193 |
T |
|
| Q |
216 |
agtagagaccaagcaatgtgatgatg |
241 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
47422194 |
attagagaccaagcaatgtgatgatg |
47422219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University