View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14718_high_8 (Length: 306)
Name: NF14718_high_8
Description: NF14718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14718_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 2332476 - 2332181
Alignment:
| Q |
1 |
attttgtaaaatatcggttgaaatccatcatttcctagggcattgtaagagtgcatagggaaaataggatcttttatcctttccatagttacaggcaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||| |||||||||| |
|
|
| T |
2332476 |
attttgtaaaatatcggttgaaatccatcatgtcctagggctttgtaagagtgcatagggaaaatagaatctttaatcctttccatagtgacaggcaaga |
2332377 |
T |
 |
| Q |
101 |
gaagctggtccatcaagttaatgctaagagatggaatattatccagttgtaaactatatgagaggtttacagggatcatttgattggaatagattcataa |
200 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
2332376 |
gaagctggtccatcaagctaatgccaagagatggaatattatccagttgtaaactatatgagaggtttacagggatcatttgattgggatagatgcataa |
2332277 |
T |
 |
| Q |
201 |
aaaactttgaggcttcccttttgagagtgcttgcattcgtgcaccatatgttttccacattcaaaccagaaattttatttcgtcgtcttctgatgatg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2332276 |
aaaactttgaggcttcccttttgagagtgcttgcattcgtgcacc--atgttttccacattcaaaccagaaattttatttcgccgtcttctgatgatg |
2332181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University