View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14718_low_15 (Length: 230)
Name: NF14718_low_15
Description: NF14718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14718_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 1221002 - 1220781
Alignment:
| Q |
1 |
accggcatttaattgggaaagaattatgggatatgtttgccatctttgtctttgtttgtgcatttctagtgtcttgccagtgagggtgttttctcttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1221002 |
accggcatttaattgggaaagaattatgggatatgtttgccatctttgtctttgtttgtgcatttctagtgtcttgccagtgagggtgttttctcttttc |
1220903 |
T |
 |
| Q |
101 |
acagggaaggcaaaaagtaaaggctacgttgggcagtcaaagatttagtatacttgtttcatgggg-----atttttcttttcacaggtcactatcgaag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1220902 |
acagggaaggcaaaaagtaaaggctacgttgggcagtcaaagatttagtatacttgtttcatggggatagcatttttcttttcacaggtcactatcgaag |
1220803 |
T |
 |
| Q |
196 |
tattgatcacttcatctctgct |
217 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
1220802 |
tattcatcacttcatctctgct |
1220781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University