View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14718_low_5 (Length: 358)
Name: NF14718_low_5
Description: NF14718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14718_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 7 - 354
Target Start/End: Original strand, 8243713 - 8244060
Alignment:
| Q |
7 |
atagagatgttcttctcctgatttttgatctatgagtttgatccaacggctaggagtactctttgaagcagtacttgaagctgcacccccaccaattcta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8243713 |
atagagatgttcttctcctgatttttgatctatgagtttgatccaacggctaggagtactctttgaagcactacttgaagctgcacccccaccaattcta |
8243812 |
T |
 |
| Q |
107 |
cttcctatgtaagcaatatccaaaccctttccaacaggcnnnnnnnccgatctaaccacacgtgtgcctctttcaagaaccatattccatttaaaccaag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8243813 |
cttcctatgtaagcaatatccaaaccctttccaacaggcaaaaaaaccgatctaaccacacgtgtgcctctttcaagaaccatattccatttaaaccaag |
8243912 |
T |
 |
| Q |
207 |
aaacatttgacctttgccatgcatttttccatgccaaaactgcccctctagtactcactttttcaaccttaagacccctagcaaaatccctaagcctaca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8243913 |
aaacatttgacctttgccatgcatttttacatgccaaaactgcccctctagtactcacttttgcaaccttaagaaccctagcaaaatccctaagcctaca |
8244012 |
T |
 |
| Q |
307 |
atccaccacaagaaaaaccaacccatcaagacttttgatcaccgtctg |
354 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8244013 |
atccaccacaagaaaatccaacccatcaagacttttgatcaccgtctg |
8244060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University