View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14719_high_14 (Length: 238)
Name: NF14719_high_14
Description: NF14719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14719_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 28417182 - 28417403
Alignment:
| Q |
1 |
tggctaatgcctcaatctagggtgatctatgatgatattgcttatcaaaatcacataattgtattatgttacaggaatctgaaattttgagctgcgtgtg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28417182 |
tggctaatgcctccatctagggtgatctatgatgatattgcttatcaaaatcacataattgtattatgttacaggaatctgaaattttgagctgcgtgtg |
28417281 |
T |
 |
| Q |
101 |
atataagaatcaagattgaaggcattgttnnnnnnntatattggcgatgatggctaactcagactctacaagtgcaattggaaagtttgttacatatgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28417282 |
atataagaatcaagattgaaggcattgttaaaaaaatatattggcgatgatggctaactcagactctacaagtgcaattggaaagtttgttacatatgat |
28417381 |
T |
 |
| Q |
201 |
aatgaa-tttgatgctaagagg |
221 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
28417382 |
aatgaattttgatgctaagagg |
28417403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 182
Target Start/End: Original strand, 28403787 - 28403828
Alignment:
| Q |
141 |
ttggcgatgatggctaactcagactctacaagtgcaattgga |
182 |
Q |
| |
|
|||| ||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
28403787 |
ttggtgatgatggctaactcagactcaaaaagtgcaattgga |
28403828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 182
Target Start/End: Complemental strand, 28586009 - 28585968
Alignment:
| Q |
141 |
ttggcgatgatggctaactcagactctacaagtgcaattgga |
182 |
Q |
| |
|
|||| ||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
28586009 |
ttggtgatgatggctaactcagactcaaaaagtgcaattgga |
28585968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University