View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14719_low_9 (Length: 293)
Name: NF14719_low_9
Description: NF14719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14719_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 40 - 277
Target Start/End: Original strand, 47212894 - 47213144
Alignment:
| Q |
40 |
agcagcattggttttggaagaggtttgttgaaaatgattatattgaagatgagaaagtaactggtggaaattcccctagcagaaatgatcttgtttctca |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47212894 |
agcagcattggttttggaagaggtttgttgaaaatgattatattgaagatgagaaagtaactggtggaaattcccctagcagaaatgatcttgtttctca |
47212993 |
T |
 |
| Q |
140 |
gttgtaaattaaaggaatttctagtactaagttgttttgtcaaataaatgcatg-------------gttattacagctaaccagactttatcattccca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47212994 |
gttgtaaattaaaggaatttctagtactaagttgttttgtcaaataaatgcatggttagattcgtttgttattacagctaaccagactttatcattccca |
47213093 |
T |
 |
| Q |
227 |
ttgtgttaagtagtttttgcttgtaacattgtagtgtttgtaagttatatt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47213094 |
ttgtgttaagtagtttttgcttgtaacattgtaatgtttgtaagttatatt |
47213144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University