View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1471_high_2 (Length: 229)
Name: NF1471_high_2
Description: NF1471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1471_high_2 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 46944 - 47155
Alignment:
| Q |
18 |
ctaagtggagatggtttagtgggattattttttgtggctatggcaaatgttcttctggtggcggtaatgatatctgccggtcacgtttccggtggccatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46944 |
ctaagtggagatggtttagtgggattattttttgtggctatggcaaatgttcttctggtggcggtaatgatatctgccggtcacgtttccggtggccatt |
47043 |
T |
|
| Q |
118 |
tgaatcccgctgtgaccttcggcctccttgttggcggccacatcaccgtcgtccggtctatcttatattggatcgatcaacatataccatctgcaggggc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||| || |
|
|
| T |
47044 |
tgaatcccgctgtgaccttcggcctccttgttggcggccacatcaccgtcgtccgttctatcttatattggattgatcaacttatagcatctgcaggagc |
47143 |
T |
|
| Q |
218 |
ttgctttcttct |
229 |
Q |
| |
|
||||| |||||| |
|
|
| T |
47144 |
ttgctatcttct |
47155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 44869 - 45041
Alignment:
| Q |
18 |
ctaagtggagatggtttagtgggattattttttgtggctatggcaaatgttcttctggtggcggtaatgatatctgccggtcacgtttccggtggccatt |
117 |
Q |
| |
|
||||||||||||| |||||||| || |||||||||||||| ||| ||| |||| ||||||| |||||||| ||||| | ||| ||||||||||||||| |
|
|
| T |
44869 |
ctaagtggagatgccttagtgggtttgttttttgtggctattgcacatgctcttgtggtggctgtaatgatctctgctgctcatatttccggtggccatt |
44968 |
T |
|
| Q |
118 |
tgaatcccgctgtgaccttcggcctccttgttggcggccacatcaccgtcgtccggtctatcttatattggat |
190 |
Q |
| |
|
|||||||||| ||||| || ||||||||||| || ||||||||||| |||| || || ||| |||||||||| |
|
|
| T |
44969 |
tgaatcccgccgtgactttgggcctccttgtcggaggccacatcactatcgttcgttcgatcctatattggat |
45041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University