View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14720_high_8 (Length: 233)
Name: NF14720_high_8
Description: NF14720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14720_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 11164683 - 11164482
Alignment:
| Q |
18 |
cactcttgttatcttcaccttcacttttacaatcaccctttcgttgtttcctccgtgatggaccaaacccagaataataatagaattcattactattcga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11164683 |
cactcttgttatcttcaccttcacttttacaatcaccctttcgttgtttcctccgcgatggaccaaacccagaataataatagaattcattactattcga |
11164584 |
T |
|
| Q |
118 |
acccgaagctgaacccaccagagacttcttcggtcggcctctactgcgtcgtggcgcctcaatgctcccgcccccattcgagtttctcttcaaacctttg |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11164583 |
acccgaagctgaacccaccagcgacttcttcggtcggcctctacagcgtcgtggcgcctcaatgctcccgcccccattcgagtttctcttcaaacctttg |
11164484 |
T |
|
| Q |
218 |
ct |
219 |
Q |
| |
|
|| |
|
|
| T |
11164483 |
ct |
11164482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 105 - 217
Target Start/End: Complemental strand, 11157654 - 11157545
Alignment:
| Q |
105 |
cattactattcgaacccgaagctgaacccaccagagacttcttcggtcggcctctactgcgtcgtggcgcctcaatgctcccgcccccattcgagtttct |
204 |
Q |
| |
|
||||| |||| ||||||||||| ||||||||| |||||||||||||||||||||| || || || |||||||||| |||||||||||| ||||||| |
|
|
| T |
11157654 |
cattattatttgaacccgaagccgaacccacc---gacttcttcggtcggcctctaccacgccgcggagcctcaatgccgccgcccccattccagtttct |
11157558 |
T |
|
| Q |
205 |
cttcaaacctttg |
217 |
Q |
| |
|
||||||||||||| |
|
|
| T |
11157557 |
cttcaaacctttg |
11157545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 4703500 - 4703693
Alignment:
| Q |
18 |
cactcttgttatcttcaccttcacttttacaatcaccctttcgttgtttcctccgtgatggaccaaacccagaataataatagaattcattactattcga |
117 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||| |||||| ||| |||| ||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
4703500 |
cactcttgttatcttcaccatcattttta---tcacctcttcgtt---tccctcgtggtggaccaaacccagaataaaaatagaattcattattattcga |
4703593 |
T |
|
| Q |
118 |
acccgaagctgaacccaccagagacttcttcggtcggcctctactgcgtcgtggcgcctcaatgctcccgcccccattcgagtttctcttcaaacctttg |
217 |
Q |
| |
|
||| ||||||||| || | ||||||||||| |||||||| || || |||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
4703594 |
acctgaagctgaatccgctttcaccttcttcggtctgcctctaccacgccgcggcgcctcaatgtctcctcccccatttgagtttctcttcaaacctttg |
4703693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University