View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14721_high_9 (Length: 303)
Name: NF14721_high_9
Description: NF14721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14721_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 188 - 288
Target Start/End: Original strand, 35364579 - 35364679
Alignment:
| Q |
188 |
acttacatttatagaaaaaatgatgaattcgtggagtatggtggctccaatagtcgtggtatcaattgaatgttgggagaagttttcgaagcataaaaac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35364579 |
acttacatttatagaaaaaatgatgaattcgtggagtatggtggctccaatagtcgtggtatcaattggatgttgggagaagttttcgaagcataaaaac |
35364678 |
T |
 |
| Q |
288 |
t |
288 |
Q |
| |
|
| |
|
|
| T |
35364679 |
t |
35364679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 15 - 114
Target Start/End: Original strand, 35364410 - 35364509
Alignment:
| Q |
15 |
cagagacaccgattaacatttctcaaatatatttacgactttaaatagaaaacaaaattacttgtcatttatcttaatcttaattatttgaaacattatg |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364410 |
cagagacacccgttaacatttctcaaataaatttacgactttaaatagaaaacaaaattacttgtcatttatcttaatcttaattatttgaaacattatg |
35364509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University