View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14721_low_13 (Length: 258)
Name: NF14721_low_13
Description: NF14721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14721_low_13 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 258
Target Start/End: Complemental strand, 26834128 - 26833884
Alignment:
| Q |
14 |
ttatgccacactggttttgtgaggccaggtctgcccctggttatttctattcttggcgcggcgtaagaccactccactacatggctatagtacgatgttg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26834128 |
ttatgccacactggttttgtgaggccaggtctgcccctgattatttctattcttggcgcggcgtaagaccactccactacatggctatagtacgatgttg |
26834029 |
T |
|
| Q |
114 |
actacataagttttagtttgctgcccnnnnnnnnnnnnnccttcacttgattttatcccgttgaatttttcaagcaaggttgttaatgaggtaatcaggt |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26834028 |
actacataagttttagtttgctgccctttttatttttttccttcacttgattttaccccgttgaatttttcaagcaaggttgttaatgaggtaatcaggt |
26833929 |
T |
|
| Q |
214 |
tttgtctttgcttccttagtttttgggctagtcttctaagtgtat |
258 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
26833928 |
tttgtctgtgtttccttagtttttgggctagtcttctaagtgtat |
26833884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 198 - 258
Target Start/End: Complemental strand, 45418984 - 45418925
Alignment:
| Q |
198 |
aatgaggtaatcaggttttgtctttgcttccttagtttttgggctagtcttctaagtgtat |
258 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
45418984 |
aatgaggtaatcaggttttgt-tttgcttccttagtttttgcgctactcttctaagtgtat |
45418925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University