View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14721_low_20 (Length: 201)
Name: NF14721_low_20
Description: NF14721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14721_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 26 - 190
Target Start/End: Original strand, 11571333 - 11571497
Alignment:
| Q |
26 |
tggaaagtaatttgaagaagaaacatgaggaaccttggctgagcaatcaaagacaaatgctggactgctatgatagacatgatcaataaaccgcaatctt |
125 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11571333 |
tggaaagtaatttgaagaagaaagatgaggaaccttggctgagcaatcaaagacaaatgctggactgctatgatggacatgatcaataaaccgcaatctt |
11571432 |
T |
 |
| Q |
126 |
agagccttagtttcaccccctttacttcttgtttatcttaacttctaatattttgtgcctatgct |
190 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11571433 |
agagccttagttgcacaccctttacttcttgtttatcttaacttctaatattttgtgcttatgct |
11571497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 28 - 88
Target Start/End: Original strand, 13306029 - 13306090
Alignment:
| Q |
28 |
gaaagtaatttgaagaagaaacatgaggaacctt-ggctgagcaatcaaagacaaatgctgg |
88 |
Q |
| |
|
||||| ||| |||||||| |||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
13306029 |
gaaagaaatatgaagaagcaacatgaggagtctttggctgagcaagcaaagacaaatgctgg |
13306090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University