View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14721_low_20 (Length: 201)

Name: NF14721_low_20

Description: NF14721

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF14721_low_20

[»] chr7 (1 HSPs)

[»] chr4 (1 HSPs)

Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)

Name: chr7

Description:

Target: chr7; HSP #1

Raw Score: 145; E-Value: 2e-76

Query Start/End: Original strand, 26 - 190

Target Start/End: Original strand, 11571333 - 11571497

Alignment:

Q	26	tggaaagtaatttgaagaagaaacatgaggaaccttggctgagcaatcaaagacaaatgctggactgctatgatagacatgatcaataaaccgcaatctt	125	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	11571333	tggaaagtaatttgaagaagaaagatgaggaaccttggctgagcaatcaaagacaaatgctggactgctatgatggacatgatcaataaaccgcaatctt	11571432	T

Q	126	agagccttagtttcaccccctttacttcttgtttatcttaacttctaatattttgtgcctatgct	190	Q
		\|\|\|\|\|\|\|\|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|
T	11571433	agagccttagttgcacaccctttacttcttgtttatcttaacttctaatattttgtgcttatgct	11571497	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 30; E-Value: 0.00000007

Query Start/End: Original strand, 28 - 88

Target Start/End: Original strand, 13306029 - 13306090

Alignment:

Q	28	gaaagtaatttgaagaagaaacatgaggaacctt-ggctgagcaatcaaagacaaatgctgg	88	Q
		\|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	13306029	gaaagaaatatgaagaagcaacatgaggagtctttggctgagcaagcaaagacaaatgctgg	13306090	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]