View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14721_low_7 (Length: 381)
Name: NF14721_low_7
Description: NF14721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14721_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 126 - 366
Target Start/End: Original strand, 6958201 - 6958441
Alignment:
| Q |
126 |
tccatggtcaaccttaatcaacaaaggaacaaccttaacaacattcacaacaatagcattattcgtattcttgatccgtttcctcgtatcactatatcca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6958201 |
tccatggtcaaccttaatcaacaaaggaacaaccttaacaacattcacaacaatagcattattcgtattcttgatccgtttcctcgtatcactataccca |
6958300 |
T |
|
| Q |
226 |
tattcaggtttcaacaccccaccaaaattcggtgatttcgaagcgcaacggcattggatggagataacaatcaatcttcctgttcgtgattggtataaaa |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6958301 |
tattcaggtttcaacaccccaccaaaattcggtgatttcgaagcgcaacggcattggatggagataacaatcaatcttcctgttcgtgattggtataaaa |
6958400 |
T |
|
| Q |
326 |
atggaacctttaatgatttgagttattggggtcttgattat |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6958401 |
atggaacctttaatgatttgagttattggggtcttgattat |
6958441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 6 - 34
Target Start/End: Original strand, 6958088 - 6958116
Alignment:
| Q |
6 |
catcatcactatcccaatctcatcacaca |
34 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6958088 |
catcatcactatcccaatctcatcacaca |
6958116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University