View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14722_low_7 (Length: 256)
Name: NF14722_low_7
Description: NF14722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14722_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 35 - 240
Target Start/End: Original strand, 2084427 - 2084632
Alignment:
| Q |
35 |
aaccctccgatcatcaagaaaaagggtatgagcaagaactattctatctaaaaatcaaactcgaacaattagttaattggtgggaaggtctgctttgtca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2084427 |
aaccctccgatcatcaagaaaaagggtatgagcaagaattattctatctaaaaatcaaactcgaacaattagttaattggtgggaaggtctgttttgtca |
2084526 |
T |
 |
| Q |
135 |
tccctactcttacggagtcacggttgttatgcatagttagcatccattataatgattgatttagcattgctaaatattgcaacaagcaccttaacgaagt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2084527 |
tccctactcttacggagtcacggttgttatgcatagttagcatccattataatgattgatttagcattgctaaatattgcaacaagcaccttaatgaagt |
2084626 |
T |
 |
| Q |
235 |
ttaatg |
240 |
Q |
| |
|
|||||| |
|
|
| T |
2084627 |
ttaatg |
2084632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University