View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14722_low_9 (Length: 236)
Name: NF14722_low_9
Description: NF14722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14722_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 2873193 - 2872998
Alignment:
| Q |
1 |
ttctttatccctctctctctggcatgcaatatgttgtttctctattggattatatacttgattttcattcaattcctgataat----tggtagcactttg |
96 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
2873193 |
ttctttatccctctatctctggcatgcaatatgttgtttctctattggat-atatacttgattttcattcaattcctgatgataatttggtagcactttg |
2873095 |
T |
|
| Q |
97 |
catcatgcttagattagcgtgtggattgacatggtaatggtgtatcatcgtgattttaactatttagaattttaagttacggtattatcataatttt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2873094 |
catcatgcttagattagcgtgtggattgacatggtaatggtgtatcatcgtgattctaacaatttagaactttaagttacggtattatcataatttt |
2872998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University