View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14723_low_23 (Length: 328)
Name: NF14723_low_23
Description: NF14723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14723_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 3 - 140
Target Start/End: Original strand, 29390604 - 29390742
Alignment:
| Q |
3 |
atactcaactttatttcccttgttattgaaacaagtagcttgtattnnnnnnnnn-cattataagcaccttatgataatgtatgattgaagtagttacga |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29390604 |
atactcaagtttatttcccttgttattgaaacaagtagcttgtattaaaaaaaaaacattataagcaccttatgataatgtatgattgaagtagttacga |
29390703 |
T |
|
| Q |
102 |
caaatagatttataaaaatatttttatgccgaagttatt |
140 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29390704 |
caaatagatttataaaaatatttctatgccgaagttatt |
29390742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 174 - 311
Target Start/End: Original strand, 29390805 - 29390942
Alignment:
| Q |
174 |
ggggccaagtccgatattttgttgtatgaatctattcttattaaatttgtacatcgtcacgtaaagaatttannnnnnnnnnnnnnggctgcaggttaag |
273 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
29390805 |
ggggctaaatccgatattttgttgtatgaatctattcttattaaatttgtacatcatcacgtaaagaatttattttttatttttttggctgcaggttaag |
29390904 |
T |
|
| Q |
274 |
aatctatttgagtcggataagggcacataaaccccttt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29390905 |
aatctatttgagtcggataagggcacataaaccccttt |
29390942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University