View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14723_low_26 (Length: 287)
Name: NF14723_low_26
Description: NF14723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14723_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 21 - 249
Target Start/End: Complemental strand, 44471200 - 44470970
Alignment:
| Q |
21 |
ttaggatctggacttgcaaaaatctgcaaattatataaagatatgt--tttcatattagttttaatctattattttcataggctatatcatgaaaaactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44471200 |
ttaggatctggacttgcaaaaatctgcaaattatataaagatatgtgttttcatattagttttaatctattattttcataggctatatcatgaaaaactt |
44471101 |
T |
 |
| Q |
119 |
gtgcgaataagctgaaaatatagctcatggacatattataagatgtgttcttaactcgcaaatacttatgttggttgataaactcatataagtaaacttg |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44471100 |
gtgcgaataagctgaaaatataggtcatggacatattataagatgtgttcttaactcgcaaatacttatgtcggttgataaactcatataagtaaacttg |
44471001 |
T |
 |
| Q |
219 |
aacttttattgttattttatacaaacattgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44471000 |
aacttttattgttattttatacaaacattgt |
44470970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University