View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14723_low_29 (Length: 255)
Name: NF14723_low_29
Description: NF14723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14723_low_29 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 85 - 255
Target Start/End: Complemental strand, 43094062 - 43093892
Alignment:
| Q |
85 |
agaaggaagagaaaagcagtgatggaactcatcaattccctttgaggcctgaagctgaagattgttcattttatatgaagactgggagttgcaagtttgg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094062 |
agaaggaagagaaaagcagtgatggaactcatcaattccctttgaggcctgaagctgaagattgttcattttatatgaagactgggagttgcaagtttgg |
43093963 |
T |
|
| Q |
185 |
attcaactgcaaatttaatcaccccattaggaggaaaaaccaaaaccaggttatttattttctctttcttc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43093962 |
attcaactgcaaatttaatcaccccattaggaggaaaaaccaaaaccaggttatttattttctctttcttc |
43093892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 126 - 208
Target Start/End: Complemental strand, 34207461 - 34207379
Alignment:
| Q |
126 |
ttgaggcctgaagctgaagattgttcattttatatgaagactgggagttgcaagtttggattcaactgcaaatttaatcaccc |
208 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| | |||||||| | |||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
34207461 |
ttgaggcctgaagctgaagactgttctttttatctcaagactggaacttgcaaatttggattcaattgcaagtttaatcaccc |
34207379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University