View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14724_low_7 (Length: 247)
Name: NF14724_low_7
Description: NF14724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14724_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 47893851 - 47894080
Alignment:
| Q |
1 |
catcccggcgaaaaagctcgccggagagaccctcaaaaatacaattattccggcaatccttgccctgagtttcgcaaattaggaaactgcaccaaaggtg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47893851 |
catcccggtgaaaaagctcgccggagagaccctcaaaaatacaattattccggcaatccttgcccggagtttcgcaaattaggaaactgcaccaaaggtg |
47893950 |
T |
 |
| Q |
101 |
attcttgccacttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgacggaaccctttgccggagacgagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893951 |
attcttgccacttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgacggaaccctttgccggagacgagt |
47894050 |
T |
 |
| Q |
201 |
ttgtttctttgctcataccattgatcaact |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47894051 |
ttgtttctttgctcataccattgatcaact |
47894080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 112 - 162
Target Start/End: Complemental strand, 38748222 - 38748172
Alignment:
| Q |
112 |
ttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaact |
162 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| || | ||||||||| |
|
|
| T |
38748222 |
ttcgctcatggcgtttttgaatgctggcttcatcctgctagatacagaact |
38748172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 183
Target Start/End: Complemental strand, 42926264 - 42926175
Alignment:
| Q |
94 |
aaaggtgattcttgccacttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgacggaacc |
183 |
Q |
| |
|
||||||||||| || | || |||||||||||||| || || |||||||||||||| |||||| | ||||||| ||||| ||||||||| |
|
|
| T |
42926264 |
aaaggtgattcgtgtgagtttgctcatggtgttttcgagtgttggcttcatccttcgcgttaccgtactcagccgtgtaaagacggaacc |
42926175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University