View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14725_low_5 (Length: 219)
Name: NF14725_low_5
Description: NF14725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14725_low_5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 47646303 - 47646521
Alignment:
| Q |
1 |
ttaatcagttaagagctctattgtgagcactggggtagtgcctcgatagattaagcttttgtctagtttgaacaatggttgcttagaaatgcaatccagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47646303 |
ttaatcagttaagagctctattgtgagcactggggtagtgcctcaatagattaagcttttgtctagtttgaacaatggttgcttagaaatgcaatccggt |
47646402 |
T |
|
| Q |
101 |
gttgaagcagaagtctaacgagttttgaaaacgtgcacttactctactaatatcttgattactacaacagtaccatcaaaacccaggataatttctttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47646403 |
gttgaagcagaagtctaacgagttttgaaaacgtgcacttactctactaatatcttgattactacaacaataccatcaaaacccaggataatttctttat |
47646502 |
T |
|
| Q |
201 |
agtttcttgcacgttttta |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47646503 |
agtttcttgcacgttttta |
47646521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University