View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14725_low_6 (Length: 207)
Name: NF14725_low_6
Description: NF14725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14725_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 21 - 192
Target Start/End: Original strand, 42709147 - 42709318
Alignment:
| Q |
21 |
tcctttcttctctataacccatgtcattaagtaaaatgcgacccctgtggctataaattccctaccagtgcaaattgagaggattacacaataggctata |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42709147 |
tcctttcttctctataacccatgtcattaagtaaagtgcgacccctgtggctataaattccctaccagcacaaattgagaggattacacaataggctata |
42709246 |
T |
 |
| Q |
121 |
tcgaggaaggtgacgttccaacccaatttccagtgctgaatgtcccttgctatggcgaaggcaacagctaaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42709247 |
gcgaggaaggtgacgttccaacccaatttccagtgctgaatgtccctttctatggcgaaggcaacagctaaa |
42709318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 96 - 192
Target Start/End: Complemental strand, 43623449 - 43623353
Alignment:
| Q |
96 |
tgagaggattacacaataggctatatcgaggaaggtgacgttccaacccaatttccagtgctgaatgtcccttgctatggcgaaggcaacagctaaa |
192 |
Q |
| |
|
||||||| ||||||||||||||||| |||||| | |||||||||||||||||||||| |||| |||||||||| ||||||| ||||||| ||||||| |
|
|
| T |
43623449 |
tgagaggtttacacaataggctatagcgaggaggctgacgttccaacccaatttccactgctcaatgtccctttctatggccaaggcaatagctaaa |
43623353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 43623591 - 43623545
Alignment:
| Q |
22 |
cctttcttctctataacccatgtcattaagtaaaatgcgacccctgt |
68 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| || |||||||||| |
|
|
| T |
43623591 |
cctttcttctctatgacccatgtcattaagtaatatccgacccctgt |
43623545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University