View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14726_high_31 (Length: 245)

Name: NF14726_high_31
Description: NF14726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14726_high_31
NF14726_high_31
[»] chr2 (1 HSPs)
chr2 (48-230)||(2052773-2052955)


Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 48 - 230
Target Start/End: Original strand, 2052773 - 2052955
Alignment:
48 agatatatagttgagaaatgattcctcataaattgagtatgttatctttcttttcgagattcatatcgattaatcatgtcattttataacatatgtcccc 147  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||    
2052773 agatatatagttgagaaatgactcctcataaattgagtatgttatctttcttttcgagattcatattgattaatcatgtcattttgtgacatatgtcccc 2052872  T
148 ataaccaaattagaccacatgtggaaaaggaacata-tttgttacatccataaaggaacttttaacgcaacataccaaataact 230  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||    
2052873 ataaccaaattagaccacatgtggaaaaggaacatattttgttacatccataaaggaacttttaacacaacata-caaataact 2052955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University