View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14726_high_9 (Length: 492)
Name: NF14726_high_9
Description: NF14726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14726_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 2e-69; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 67 - 240
Target Start/End: Original strand, 19872251 - 19872427
Alignment:
| Q |
67 |
ttgacaatcaatttgggaattattggt--tagggttcttgaataatattgatattttatttttatgttttcttaaaatcgtaattgatgaggtgaaaatg |
164 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19872251 |
ttgacaatcaatatgggaattattggtattagggttcttgaataatattgatattttatttttatgttttcttaaaatcgtaattgatgaggtgaaaatg |
19872350 |
T |
|
| Q |
165 |
atggaccatgtagatactattatgtagaatccatgt-actgatcagcacgccatatcattcaaaaagtaagagaacc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| | |||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
19872351 |
atggaccatgtagatactattatgtagaacccatgtcattgatgagcaagtcatatcattcaaaaagtaagagaacc |
19872427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 372 - 473
Target Start/End: Original strand, 19872560 - 19872661
Alignment:
| Q |
372 |
ggacttggcatgcaataataagcattaccaaaccagaaccctttgcataggccttgactacnnnnnnncttctttctccataatgaactcacaagacttc |
471 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19872560 |
ggacttggcatgcaataataagcattaccaaaccagaaccctttgcataggccttgactactttttatcttctttctccataatgaactcacaagacttc |
19872659 |
T |
|
| Q |
472 |
ct |
473 |
Q |
| |
|
|| |
|
|
| T |
19872660 |
ct |
19872661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 20 - 49
Target Start/End: Original strand, 19872204 - 19872233
Alignment:
| Q |
20 |
atgattgaagcggaaaatctatgtatctct |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19872204 |
atgattgaagcggaaaatctatgtatctct |
19872233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University