View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14726_low_21 (Length: 295)
Name: NF14726_low_21
Description: NF14726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14726_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 71 - 164
Target Start/End: Original strand, 10819176 - 10819269
Alignment:
| Q |
71 |
agaacgagttacttgaaaacttaagctatataacttataaaatatgcaatatcaaagagggttcacgaagtttctcaagcaaatacttgagtcc |
164 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10819176 |
agaacaagttacttgaaaacttaagctatataatttataaaatatgcaatatcaaagagtgttcacgaagtttctcaagcaaatacttgagtcc |
10819269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 55
Target Start/End: Original strand, 10819115 - 10819158
Alignment:
| Q |
12 |
gtcgaagaatattcagcgcaccacattcagagttacttgaaaac |
55 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
10819115 |
gtcgaacaaaattcagcgcaccacattcagagttacttgaaaac |
10819158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University