View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14726_low_26 (Length: 267)
Name: NF14726_low_26
Description: NF14726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14726_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 40174042 - 40173840
Alignment:
| Q |
1 |
ttgaaggtattagattttggggtgtagtgaacggtagaggaggggtaagtgtgtgaatttggggttgtgatagatggatgaaaaggaaatcgaagagatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174042 |
ttgaaggtattagattttggggtgtagtgaacggtagaggaggggtaagtgtgtgaatttgggggtgtgatagatggatgaaaaggaaatcgaagagatt |
40173943 |
T |
|
| Q |
101 |
gtagtgttgttgccattgacttgttccgattttgaaataaaaatgaaccctagaatagatgagagtgtgaagagaaagccacagatattttcagtggcgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40173942 |
gtagtgttgttgccattgacttgttccgattttgaaataaaaatgaaccctagaatagatgagagtgtgaagagaaagccacagatattttcagtggcgg |
40173843 |
T |
|
| Q |
201 |
gag |
203 |
Q |
| |
|
||| |
|
|
| T |
40173842 |
gag |
40173840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University