View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14726_low_36 (Length: 245)
Name: NF14726_low_36
Description: NF14726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14726_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 48 - 230
Target Start/End: Original strand, 2052773 - 2052955
Alignment:
| Q |
48 |
agatatatagttgagaaatgattcctcataaattgagtatgttatctttcttttcgagattcatatcgattaatcatgtcattttataacatatgtcccc |
147 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
2052773 |
agatatatagttgagaaatgactcctcataaattgagtatgttatctttcttttcgagattcatattgattaatcatgtcattttgtgacatatgtcccc |
2052872 |
T |
 |
| Q |
148 |
ataaccaaattagaccacatgtggaaaaggaacata-tttgttacatccataaaggaacttttaacgcaacataccaaataact |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
2052873 |
ataaccaaattagaccacatgtggaaaaggaacatattttgttacatccataaaggaacttttaacacaacata-caaataact |
2052955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University