View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14727_high_6 (Length: 244)
Name: NF14727_high_6
Description: NF14727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14727_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 34 - 230
Target Start/End: Original strand, 28937531 - 28937727
Alignment:
| Q |
34 |
gaggtggtgattgaggagagtgtttgaatcaagagttcgggttccaatgctttttaactttgctttttgaagcaattttgatatctgttgaaaaacgaag |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
28937531 |
gaggtggtgattgaggagagtgtttgaatcaagagtttgggttccaatgctttttaactttgctttttgaagcaatttcggtatctattgaaaaacgaag |
28937630 |
T |
 |
| Q |
134 |
tccaaataatgcttggtaaattccatgctttagtggattgatgacgaatgtgatgaatttggacatgttcaaaggttttcggtatagaccgaataat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28937631 |
tccaaataatgcttggtaaattccatgctttagtggattgatgacgaatgtgatgaatttggacatgttcaaaggttttcggtatagactgaataat |
28937727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University