View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14727_low_7 (Length: 216)
Name: NF14727_low_7
Description: NF14727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14727_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 8264515 - 8264318
Alignment:
| Q |
1 |
ccaaatatgaatagggtttctattagatattttgaagtgggtgatttatctcctatcttcaaaatcaacctcccatgcaggttctttatgaatccttcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8264515 |
ccaaatatgaatagggtttctattagatattttgaagtgggtgatttatctcctatcttcaaaatcaacctcccatgcaggttctttatgaatccttcga |
8264416 |
T |
|
| Q |
101 |
ctccctttgatgtatatgtcctcagagatttcgattgtaatctagtaacctttcaaatagggtgagggcaagtcagtgatggtgaaatgtgcgatatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
8264415 |
ctccctttgatgtatatgtcctcagagatttcgattgtaatctagtaacctttcaaatagggtgagggtaagtcagtgatggtgaaatttgcgatatt |
8264318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 30 - 155
Target Start/End: Original strand, 16574730 - 16574854
Alignment:
| Q |
30 |
ttttgaagtgggtgatttatctcctatcttcaaaatcaacctcccatgcaggttctttatgaatccttcgactccctttgatgtatatgtcctcagagat |
129 |
Q |
| |
|
||||| |||||| |||||||||||| |||| ||||||||||||||||| ||| | | | || || |||| | |||| ||| ||||| ||||||||||| |
|
|
| T |
16574730 |
ttttgcagtgggagatttatctcctttcttaaaaatcaacctcccatggaggatatctttgcattcttcaattccc-ttggtgtattcatcctcagagat |
16574828 |
T |
|
| Q |
130 |
ttcgattgtaatctagtaacctttca |
155 |
Q |
| |
|
|| ||||| ||| |||| |||||||| |
|
|
| T |
16574829 |
tttgattgaaatttagtcacctttca |
16574854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University