View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_high_19 (Length: 360)
Name: NF14728_high_19
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 11 - 344
Target Start/End: Original strand, 5746711 - 5747044
Alignment:
| Q |
11 |
ataatactccatcaatgttcaacccatactactaaccatatttccgtcggtattgcaactttttcaagttaatgacataaacattaagaaaagaagaagn |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5746711 |
ataatactccatcaatgttcaacccatactactaaccatatttctgtcggtaatgcaactttttcaagttaatgacataaacattaagaaaagaagaaga |
5746810 |
T |
|
| Q |
111 |
nnnnnnncctgtggtgaagtatttctccggagtcgaaccctaattcatttctttcatcacaaggtatatcaagaattggcttatgatcatactcatcact |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5746811 |
aaaaaaacctgtggtgaagtatttctccggagtcgaaccctaattcatttctttcatcacaaggtatatcaagaattggcttatgatcatactcatcact |
5746910 |
T |
|
| Q |
211 |
agcattactactttggccatgcaatgacaatgatgatagagaaatagccccccaattattattatgttgttgcaaaggagttgtattaacactactacta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5746911 |
agcattactactttggccatgcaatgacaatgatgatagagaaatagccccccaattattattatgttgttgcaaaggagttgtattaacactactacta |
5747010 |
T |
|
| Q |
311 |
tttctttcttcagtcataatgtattgttcttgtt |
344 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
5747011 |
tttctttcttcagttataatgtattgttcttgtt |
5747044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University