View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_high_26 (Length: 328)
Name: NF14728_high_26
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 39357554 - 39357240
Alignment:
| Q |
1 |
catgacccttatttcaagcgaaaaatggtttcattcaacaaatcattgtgtatcctattttcagtatggttctttcaaatcattgtatatctttctctat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39357554 |
catgacccttatttcaagcgaaaaatggtttcattcaacaaatcattgtatatcctattttcagtatggttctttcaaatcattgtatatctttctctat |
39357455 |
T |
 |
| Q |
101 |
tactgagatttcaatatcttgccgccatggggtaaagtcatgtcgtatctatggaacaggtagcaagattgatgctgatgctaacaagtaccttaattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39357454 |
tactgagatttcaatatcttgccgccatggggtaaagtcatgtcgtatctatggaacaggtagcaagattgatgctgatgctaacaagtaccttaattga |
39357355 |
T |
 |
| Q |
201 |
taattacattatttttctagacataagnnnnnnnnnnctcttctctttaaagaatattttagaacacttgttagcatttttcattactttctctgtctca |
300 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39357354 |
taattacattatttttctagacataagttttttttttctcttctctttaaagaatattttagaacacttgttagcatttttcattactttctctgtctca |
39357255 |
T |
 |
| Q |
301 |
ccgtcacgttgtttt |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39357254 |
ccgtcacgttgtttt |
39357240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 87 - 158
Target Start/End: Complemental strand, 39343200 - 39343129
Alignment:
| Q |
87 |
atatctttctctattactgagatttcaatatcttgccgccatggggtaaagtcatgtcgtatctatggaaca |
158 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| | ||||| ||| ||||| |||||||| |||||| |
|
|
| T |
39343200 |
atatctttctctatcaatgagatttcaatatcttgctgttgtgggggaaaatcatgccgtatctaaggaaca |
39343129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University