View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_high_31 (Length: 294)
Name: NF14728_high_31
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 38319138 - 38319412
Alignment:
| Q |
1 |
gctttgattctttttggtgtgaggaatgtgtgttgttttcatcaatnnnnnnnnnnnnn----gtacaattttaattagccactaaattatgaattgaag |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38319138 |
gctttgattctttttggtgtgaggaatgtgtgttgttttcatcaataaaaaataaaataaaaagtacaattttaattagccactaaattatgaattgaag |
38319237 |
T |
 |
| Q |
97 |
gttaggtattatatatccaaagtatggagtaggttattatcacttaaaaaatggacgattttatagattaatgacatgtttgaaatgacaataaaatcat |
196 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38319238 |
gttaggtat---atatccaaagtatggagtaggttattatcacttaaaaaatggtcgattttatagattaatgacatgtttgaaatgacaataaaatcat |
38319334 |
T |
 |
| Q |
197 |
gttaaaccactacgattttggcataagctacattttaaagtttcgattaatcgaaccctgcataacttcttggtcttg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
38319335 |
gttaaaccactacgattttggcataagctacattatgaagtttctattaatcgaacgctgcataacttcttggtcttg |
38319412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University