View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_high_36 (Length: 280)
Name: NF14728_high_36
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_high_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 122 - 262
Target Start/End: Original strand, 27223742 - 27223882
Alignment:
| Q |
122 |
cagagcttataatataagggtttgagcacctaacaagtgttagaggagagattcaaaaagaagtaaatagatgatcaatgaatttcaccagcaaacttca |
221 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
27223742 |
cagagcttaaactatgagggtttgagcacctaacaagtgttagaggaaagattcagaaagaagtaaatagatgatcaaagaatttcaccagcaaacttta |
27223841 |
T |
|
| Q |
222 |
tcacatataagaaggttctcaatcaaaaccacatttcttca |
262 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27223842 |
tcacatataagaaggttctcaatcaagaccacatttcttca |
27223882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 6 - 51
Target Start/End: Original strand, 27223544 - 27223589
Alignment:
| Q |
6 |
ttatgagactagactagtctaattaaggtgaaccataataacttgt |
51 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
27223544 |
ttatgggactagactagtctagttagggtgaaccataataacttgt |
27223589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University