View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_high_44 (Length: 246)
Name: NF14728_high_44
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_high_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 97 - 237
Target Start/End: Complemental strand, 38543645 - 38543505
Alignment:
| Q |
97 |
gatagaaaatcatatactaaactaatgtaatcaactactttataacttttgttgagacagtgttaattatagataatattttattaattttaatagaata |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38543645 |
gatagaaaatcatatactaaactaatgtaatcaactactttataacttttgttgaaacagtgtttattatagataatattttattaattttaatagaata |
38543546 |
T |
|
| Q |
197 |
tgagannnnnnnnatcaagtactagatttttattgaaagta |
237 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
38543545 |
tgagattttttttatcaagtactagatttttattgaaagta |
38543505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Complemental strand, 5231935 - 5231903
Alignment:
| Q |
166 |
tagataatattttattaattttaatagaatatg |
198 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
5231935 |
tagataatattttattaattttagtagaatatg |
5231903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University