View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_high_51 (Length: 230)
Name: NF14728_high_51
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_high_51 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 172 - 230
Target Start/End: Complemental strand, 35757790 - 35757732
Alignment:
| Q |
172 |
tatgtttcaacataattaattcttcgtatttgttcgttatttagtttgtataaatcatt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35757790 |
tatgtttcaacataattaattcttcgtatttattcgttatttagtttgtataaatcatt |
35757732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University