View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_high_7 (Length: 487)
Name: NF14728_high_7
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_high_7 |
 |  |
|
| [»] scaffold0189 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 323; Significance: 0; HSPs: 2)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 149 - 483
Target Start/End: Original strand, 14092 - 14426
Alignment:
| Q |
149 |
gtagatggattatatcgatttattattcagttctagtgaacaatattttaagtcatttgtgtatcctttattggatgaaactcgagcacaactatgttct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14092 |
gtagatggattatatcgatttattattcagttctagtgaacaatattttaagtcatttgtgtatcctttattggatgaaactcgagcacaactatgttct |
14191 |
T |
 |
| Q |
249 |
tccatggaaattttgtcaacttcaccttatgcagaagtgatttcacttgaggagtcaagatcacattcatatggtaggaatcactacgtcgttaaaactg |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14192 |
tccatggaaattttgtcaacttcaccttatgcagaagtgatttcacttgaggagtcaagatcacattcatatggtaggaatcactacgtcgttaaaactg |
14291 |
T |
 |
| Q |
349 |
atacttggaaaaacaggtcctctgttcatggaaaagagttatacaaaacattgtttggcgatgtttttattttggcagattttaaacctgaaacggttaa |
448 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14292 |
atacttggaaaaacaggtcctctggtcatggaaaagagttatacaaaacattgtttggcgatgtttttattttggcagattttaaacctgaaacggttaa |
14391 |
T |
 |
| Q |
449 |
tgattcgcaaaggtcaggaagaccgtggagttttg |
483 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||| |
|
|
| T |
14392 |
tgatttgcaaaggtcaggaagaacgtggagttttg |
14426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 49 - 101
Target Start/End: Original strand, 13993 - 14045
Alignment:
| Q |
49 |
tttacaaaaacaaggttttgaaaacttctttctcttactctatcacattatca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13993 |
tttacaaaaacaaggttttgaaaacttctttctcttactctatcacattatca |
14045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University