View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_low_26 (Length: 331)
Name: NF14728_low_26
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 131 - 329
Target Start/End: Original strand, 30901514 - 30901712
Alignment:
| Q |
131 |
ttccttttgtttttgtttcttcaagataatggaaaagtctttagctggggatggaacaaatatggacaggtgagtatattgcgctgccatttttatttat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30901514 |
ttccttttgtttttgtttcttcaagataatggaaaagtctttagctggggatggaacaaatatggacaggtgagtatattgcgctgccatttttatttat |
30901613 |
T |
 |
| Q |
231 |
ctcctattttaaaaatgaatattattgaaagttctacctgacatacttatttaagggataatcttgaagtttggtgaattaatggcaatattttcttgg |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
30901614 |
ctcctattttaaaaatgaatattattgaaagttctacctgacatacttatttaagggataatcttgaagtttgttgaattaatggcaatatattcttgg |
30901712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 16 - 121
Target Start/End: Original strand, 30901309 - 30901414
Alignment:
| Q |
16 |
cttaattgtcagttgaatttatcaaaagtcaacaatgacattcgtgctagtttagttatttgaatcatctttggagggttggctatatgaattgtataat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30901309 |
cttaattgtcagttgaatttatcaaaagtcaacaatgacattcgtgctagtttagttatttgaatcatctttggagggttggctatatgaattgtataat |
30901408 |
T |
 |
| Q |
116 |
gtaata |
121 |
Q |
| |
|
|||||| |
|
|
| T |
30901409 |
gtaata |
30901414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University