View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_low_39 (Length: 284)
Name: NF14728_low_39
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 93
Target Start/End: Original strand, 35850362 - 35850437
Alignment:
| Q |
18 |
agaactgttttcctcacctttgcctttcttgcaagaaatacttggtccgacatattggttagactgtatagtataa |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35850362 |
agaactgctttcctcacctttgcctttcttgcaagaaccacttggtccgatcaattggttagactgtatattataa |
35850437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University