View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14728_low_39 (Length: 284)

Name: NF14728_low_39
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14728_low_39
NF14728_low_39
[»] chr5 (1 HSPs)
chr5 (18-93)||(35850362-35850437)


Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 93
Target Start/End: Original strand, 35850362 - 35850437
Alignment:
18 agaactgttttcctcacctttgcctttcttgcaagaaatacttggtccgacatattggttagactgtatagtataa 93  Q
    ||||||| |||||||||||||||||||||||||||||  |||||||||||   ||||||||||||||||| |||||    
35850362 agaactgctttcctcacctttgcctttcttgcaagaaccacttggtccgatcaattggttagactgtatattataa 35850437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University