View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_low_40 (Length: 283)
Name: NF14728_low_40
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 112 - 269
Target Start/End: Original strand, 38544265 - 38544422
Alignment:
| Q |
112 |
caaaggtgattaactgcatttgcaatataggagaaagtagtagaaactaaactaaaatggttcgcgtttatttcgttgcttttgaggtaattccatctgc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38544265 |
caaaggtgattaactgcatttgcaatataggagaaagtagtagaaactaaactaaaatggttcgcgtttatttcgttgcttttgaggtaattccatctgc |
38544364 |
T |
 |
| Q |
212 |
atgcacggaagctctgtccagaagctaaaataatgagcacggattttactttgaacgt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38544365 |
atgcacggaagctctgtccagaagctaaaataatgagcacggattttactttgaacgt |
38544422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 2 - 114
Target Start/End: Original strand, 38543807 - 38543919
Alignment:
| Q |
2 |
taaaatagttttttctttctttcttccgaatatgatgcttttaacctctatatattccaatgacttgatgccaatttttgtacaatagtatagtgctttg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38543807 |
taaaatagttttttctttctttcttccgaatatgatgcttttaacctctatatattccaatgacttgatgccaatttttgtacaatagtatagtgctttg |
38543906 |
T |
 |
| Q |
102 |
attataaactcaa |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38543907 |
attataaactcaa |
38543919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 155 - 220
Target Start/End: Original strand, 38551736 - 38551801
Alignment:
| Q |
155 |
aaactaaactaaaatggttcgcgtttatttcgttgcttttgaggtaattccatctgcatgcacgga |
220 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| ||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
38551736 |
aaactaaagtaaaatggttcacgtttattttgtttctttagaggcaattccatctgcatgcacgga |
38551801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University