View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_low_46 (Length: 252)
Name: NF14728_low_46
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 33048248 - 33048492
Alignment:
| Q |
1 |
caattctcatgacgatgggagttgataaatgtcgtgaccaatcccactgactttatgaactacatatgtgtatcctaaaaatgagttggttagcgctata |
100 |
Q |
| |
|
|||||||||||| || ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
33048248 |
caattctcatgatgacgggagttgataaatggcgtgaccaatccccctgactttatgaactacatatgtgtatcctgaaaatgagttggttcgcgctatg |
33048347 |
T |
 |
| Q |
101 |
aactattttctctaagcttatcccgcttgcac------tcaccacatagaatgctaccactataaatagataacttgtaactactttgtaacgaggtcaa |
194 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
33048348 |
aattattttctctaagcttatcccgcttgcactgaagttaaccgcatagaatgctaccactataaatagattacttgtaactactttgtaaccaggtcaa |
33048447 |
T |
 |
| Q |
195 |
ttcattctatagattcaattttctctcattttctccttgcctttg |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33048448 |
ttcattctatagattcagttttctctcattttctccttgcctttg |
33048492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University