View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_low_55 (Length: 236)
Name: NF14728_low_55
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 14 - 165
Target Start/End: Complemental strand, 9471209 - 9471060
Alignment:
| Q |
14 |
ataattctcaagcacttggtaatattgaacatacacagacaatattttcaagcatatcataatgcacttacaatgtcatgaaatagacttccaatacata |
113 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |||||| |||| ||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9471209 |
ataagtctcaagcacttgataatattgaacatacacagttaatatt--caagaatatcataacgcacttacaatttcatgaaatagacttccaatacata |
9471112 |
T |
 |
| Q |
114 |
tattgactaatgtgtcttgtaatgataatgaaatcagaatctgctcacttag |
165 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||| ||| ||||||||||| |
|
|
| T |
9471111 |
tattgactgatgtgtcttgtaatgataatgacatcaaaatatgctcacttag |
9471060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 60 - 164
Target Start/End: Complemental strand, 53693072 - 53692969
Alignment:
| Q |
60 |
ttcaagcatatcataatgcacttacaatgtcatgaaatagacttccaatacatatattgactaatgtgtcttgtaatgataatgaaatcagaatctgctc |
159 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||| ||||| ||| |
|
|
| T |
53693072 |
ttcaagcatatcataatgcacttccaatgtcatgaaatagacttccaatacatatattgactaatgtgtc-tgtattgataatgacatcaaaatcttctc |
53692974 |
T |
 |
| Q |
160 |
actta |
164 |
Q |
| |
|
||||| |
|
|
| T |
53692973 |
actta |
53692969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 162 - 218
Target Start/End: Complemental strand, 27652468 - 27652412
Alignment:
| Q |
162 |
ttagatcatgtaaagaatatgaataatcttagatgcacaaaatttgcatgcttggaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27652468 |
ttagatcatgtaaagaatatgaataatcttaggtgcacaaaatttgcatgcttggaa |
27652412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University