View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_low_58 (Length: 227)
Name: NF14728_low_58
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 45508102 - 45508296
Alignment:
| Q |
17 |
atatcgaagtgcataaatgttacttttgaaatatggtaccaaacacctttgcggaatgcctcaatatgagaaacatttagcacagacacacccaatttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45508102 |
atatcgaagtgcataaatgttacttttgaaatatggtaccaaacacctttgcggaatgcctcaatatgagaaacatttagcacagacacacccaatttct |
45508201 |
T |
 |
| Q |
117 |
taccatttgggtatggagaaaattaggtgaccattcttttgtatcatctcatgcccttttatagaggatagatccatgccaaaggatgtagtata |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45508202 |
taccatttgggtatggagaaaattaggtgaccattcttttgtatcatctcatgcccttttatagaggatagatccatgccaaaggatgtagtata |
45508296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 19846358 - 19846164
Alignment:
| Q |
17 |
atatcgaagtgcataaatgttacttttgaaatatggtaccaaacacctttgcggaatgcctcaatatgagaaacatttagcacagacacacccaatttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19846358 |
atatcgaagtgcataaatgttacttttgaaatatggtaccaaacacctttgcggaatgcctcaatatgagaaacatttagcacagacacacccaatttct |
19846259 |
T |
 |
| Q |
117 |
taccatttgggtatggagaaaattaggtgaccattcttttgtatcatctcatgcccttttatagaggatagatccatgccaaaggatgtagtata |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19846258 |
taccatttgggtatggagaaaattaggtgaccattcttttgtatcatctcatgcccttttatagaggatagatccatgccaaaggatgtagtata |
19846164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University