View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_low_60 (Length: 224)
Name: NF14728_low_60
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 6435221 - 6435032
Alignment:
| Q |
18 |
taacttaattgataacatggaaaatgatttgctatatgagaaattgtgtaactta-ttgataacatggaaaatgacttgctatatgagaaattatctaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6435221 |
taacttaattgataacatggaaaatgacttgctatatgagaaattgtgcaacttaattgataacatggaaaatgacttgctatatgagaaattatctaga |
6435122 |
T |
 |
| Q |
117 |
taatgttttgtatcaaattaagttatttctatgaaatagaataannnnnnnnagtttatcatatatcccctccgctattaccaaggttat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6435121 |
taatgttttgtatcaaattaagttatttctatgaaatataataattttttttagtttatcatatatcccctccgctattaccaaggttat |
6435032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 62 - 206
Target Start/End: Complemental strand, 29430092 - 29429947
Alignment:
| Q |
62 |
tgtgtaactta-ttgataacatggaaaatgacttgctatatgagaaattatctagataatgttttgtatcaaattaagttatttctatgaaatagaataa |
160 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29430092 |
tgtgtaacttaattgataacatggaaaatgacttgctaaatgagaaattatctagataatattttgtatcaaattaagttatttctatgaaatagaataa |
29429993 |
T |
 |
| Q |
161 |
nnnnnnnnagtttatcatatatcccctccgctattaccaaggttat |
206 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
29429992 |
ttttttttggtttatcataaatcccctccgctattatcaaggttat |
29429947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 29430088 - 29430044
Alignment:
| Q |
18 |
taacttaattgataacatggaaaatgatttgctatatgagaaatt |
62 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
29430088 |
taacttaattgataacatggaaaatgacttgctaaatgagaaatt |
29430044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University